Cyclin D1通过促进糖酵解改善肾脏缺血再灌注诱导的急性肾损伤的机制

doi:10.3969/j.issn.1006-5725.2024.21.009

Abstract

Abstract:

Objective To investigate the impact of CCND1 on renal ischemia?reperfusion?induced acute kidney injury through the promotion of glycolysis and elucidate its underlying molecular mechanism， thereby offering a novel therapeutic target for acute kidney injury. Methods We selected 8?week?old male C57BL/6 mice to establish a model of renal ischemia?reperfusion injury (IRI). To investigate the role of CCND1 in acute kidney injury (AKI)， we employed a CCND1 overexpression plasmid and a CCND1 interference plasmid for both in vivo and in vitro experiments. Kidney function was evaluated using creatinine and urea nitrogen test kits， while glycolysis and indicators of renal tubule epithelial cell damage were assessed through quantitative real?time PCR， Western blotting， immunohistochemistry， and immunofluorescence techniques. Results In the model of renal ischemia?reperfusion?induced acute renal injury， down?regulation of CCND1 expression in renal tubular epithelial cells resulted in cellular and tissue damage. However， when an overexpression plasmid for CCND1 was administered in vivo， it significantly improved kidney function and reduced kidney injury in IRI mice. The overexpression of CCND1 promoted glycolysis， pyruvate production， and increased energy production. We further confirmed the role of CCND1 in vitro where its overexpression promoted glycolysis， enhanced energy production， and alleviated AKI. Conversely， knockdown of CCND1 inhibited glycolysis leading to severe impairment in cell energy production and exacerbation of injury. Conclusions In summary， down?regulation of CCND1 expression in renal tubular epithelial cells is observed in acute kidney injury， while overexpression of CCND1 can ameliorate acute kidney injury induced by renal ischemia?reperfusion. This mechanism may be attributed to the promotion of glycolysis and timely restoration of energy supply to cells and tissues facilitated by CCND1 overexpression.

Key words: renal ischemia?reperfusion injury, acute kidney injury, tubular epithelial cells, Cyclin D1, glycolysis, energy metabolism

CLC Number:

R692

Yuliang HUANG,Ying TANG,Wenjuan YU,Junzhe. CHEN. The mechanism of cyclin D1 ameliorates renal ischemia⁃reperfusion⁃induced acute kidney injury by promotingglycolysis[J]. The Journal of Practical Medicine, 2024, 40(21): 3013-3022.

Figures/Tables 10

Tab.1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

Fig.7

Fig.8

Fig.9

References 37

1	BASILE D P， ANDERSON M D， SUTTON T A. Pathophysiology of acute kidney injury ［J］. Compr Physiol， 2012， 2（2）：1303-1353.
2	VENKATACHALAM M A， WEINBERG J M， KRIZ W， et al. Failed Tubule Recovery， AKI-CKD Transition， and Kidney Disease Progression ［J］. J Am Soc Nephrol， 2015， 26（8）： 1765-1776. doi:10.1681/asn.2015010006 doi: 10.1681/asn.2015010006
3	BOUCHARD J， ACHARYA A， CERDA J， et al. A Prospective International Multicenter Study of AKI in the Intensive Care Unit ［J］. Clin J Am Soc Nephrol， 2015， 10（8）： 1324-1331. doi:10.2215/cjn.04360514 doi: 10.2215/cjn.04360514
4	HOSTE E A， BAGSHAW S M， BELLOMO R， et al. Epidemiology of acute kidney injury in critically ill patients： the multinational AKI-EPI study ［J］. Intensive Care Med， 2015， 41（8）： 1411-1423. doi:10.1007/s00134-015-3934-7 doi: 10.1007/s00134-015-3934-7
5	RONCO C， BELLOMO R， KELLUM J A. Acute kidney injury ［J］. Lancet， 2019， 394（10212）： 1949-1964. doi:10.1016/s0140-6736(19)32563-2 doi: 10.1016/s0140-6736(19)32563-2
6	KELLUM J A. Acute kidney injury ［J］. Nat Rev Dis Primers， 2021， 7（1）： 52. doi:10.1038/s41572-021-00291-0 doi: 10.1038/s41572-021-00291-0
7	HOTCHKISS R S. Cell death ［J］. N Engl J Med， 2009， 361（16）： 1570-1583. doi:10.1056/nejmra0901217 doi: 10.1056/nejmra0901217
8	SHI H， GAO Y， DONG Z， et al. GSDMD-Mediated Cardiomyocyte Pyroptosis Promotes Myocardial I/R Injury ［J］. Circ Res， 2021， 129（3）： 383-396. doi:10.1161/circresaha.120.318629 doi: 10.1161/circresaha.120.318629
9	VAN DER RIJT S， LEEMANS J C， FLORQUIN S， et al. Immunometabolic rewiring of tubular epithelial cells in kidney disease ［J］. Nat Rev Nephrol， 2022， 18（9）： 588-603. doi:10.1038/s41581-022-00592-x doi: 10.1038/s41581-022-00592-x
10	CHAWLA L S， EGGERS P W， STAR R A， et al. Acute kidney injury and chronic kidney disease as interconnected syndromes ［J］. N Engl J Med， 2014， 371（1）： 58-66. doi:10.1056/nejmra1214243 doi: 10.1056/nejmra1214243
11	KWIATKOWSKA E， KWIATKOWSKI S， DZIEDZIEJKO V， et al. Renal Microcirculation Injury as the Main Cause of Ischemic Acute Kidney Injury Development ［J］. Biology （Basel）， 2023， 12（2）： 327. doi:10.3390/biology12020327 doi: 10.3390/biology12020327
12	LEVEY A S. Defining AKD： The Spectrum of AKI， AKD， and CKD ［J］. Nephron， 2022， 146（3）： 302-305. doi:10.1159/000516647 doi: 10.1159/000516647
13	WANG Z， YING Z， BOSY-WESTPHAL A， et al. Specific metabolic rates of major organs and tissues across adulthood： evaluation by mechanistic model of resting energy expenditure ［J］. Am J Clin Nutr， 2010， 92（6）： 1369-1377. doi:10.3945/ajcn.2010.29885 doi: 10.3945/ajcn.2010.29885
14	SABBAHY M EL， VAIDYA V S. Ischemic kidney injury and mechanisms of tissue repair ［J］. Wiley Interdiscip Rev Syst Biol Med， 2011， 3（5）： 606-618. doi:10.1002/wsbm.133 doi: 10.1002/wsbm.133
15	FORBES J M. Mitochondria-Power Players in Kidney Function？［J］. Trends Endocrinol Metab， 2016， 27（7）： 441-442. doi:10.1016/j.tem.2016.05.002 doi: 10.1016/j.tem.2016.05.002
16	ISAKA Y， KIMURA T， TAKABATAKE Y. The protective role of autophagy against aging and acute ischemic injury in kidney proximal tubular cells ［J］. Autophagy， 2011， 7（9）： 1085-1087. doi:10.4161/auto.7.9.16465 doi: 10.4161/auto.7.9.16465
17	MALEK M， NEMATBAKHSH M. Renal ischemia/reperfusion injury； from pathophysiology to treatment ［J］. J Renal Inj Prev， 2015， 4（2）： 20-27.
18	MULUKUTLA B C， YONGKY A， LE T， et al. Regulation of Glucose Metabolism-A Perspective From Cell Bioprocessing ［J］. Trends Biotechnol， 2016， 34（8）： 638-651. doi:10.1016/j.tibtech.2016.04.012 doi: 10.1016/j.tibtech.2016.04.012
19	WEN L， LI Y， LI S， et al. Glucose Metabolism in Acute Kidney Injury and Kidney Repair ［J］. Front Med （Lausanne）， 2021， 8： 744122. doi:10.3389/fmed.2021.744122 doi: 10.3389/fmed.2021.744122
20	CANTELMO A R， CONRADI L C， BRAJIC A， et al. Inhibition of the Glycolytic Activator PFKFB3 in Endothelium Induces Tumor Vessel Normalization， Impairs Metastasis， and Improves Chemotherapy ［J］. Cancer Cell， 2016， 30（6）： 968-985. doi:10.1016/j.ccell.2016.10.006 doi: 10.1016/j.ccell.2016.10.006
21	DICKMAN K G， MANDEL L J. Differential effects of respiratory inhibitors on glycolysis in proximal tubules ［J］. Am J Physiol， 1990， 258（6 Pt 2）： F1608-1615. doi:10.1152/ajprenal.1990.258.6.f1608 doi: 10.1152/ajprenal.1990.258.6.f1608
22	SHERR C J， ROBERTS J M. Living with or without cyclins and cyclin-dependent kinases ［J］. Genes Dev， 2004， 18（22）： 2699-2711. doi:10.1101/gad.1256504 doi: 10.1101/gad.1256504
23	ALAO J P， GAMBLE S C， STAVROPOULOU A V， et al. The cyclin D1 proto-oncogene is sequestered in the cytoplasm of mammalian cancer cell lines ［J］. Mol Cancer， 2006， 5：7. doi:10.1186/1476-4598-5-7 doi: 10.1186/1476-4598-5-7
24	TCHAKARSKA G， SOLA B. The double dealing of cyclin D1 ［J］. Cell Cycle， 2020， 19（2）：163-178. doi:10.1080/15384101.2019.1706903 doi: 10.1080/15384101.2019.1706903
25	PESTELL R G. New roles of cyclin D1 ［J］. Am J Pathol， 2013， 183（1）： 3-9. doi:10.1016/j.ajpath.2013.03.001 doi: 10.1016/j.ajpath.2013.03.001
26	LIU G X， LI YQ， HUANG X R， et al. Smad7 inhibits AngII-mediated hypertensive nephropathy in a mouse model of hypertension ［J］. Clin Sci （Lond）， 2014， 127（3）： 195-208. doi:10.1042/cs20130706 doi: 10.1042/cs20130706
27	FU S， TANG Y， HUANG X R， et al. Smad7 protects against acute kidney injury by rescuing tubular epithelial cells from the G1 cell cycle arrest ［J］. Clin Sci （Lond）， 2017， 131（15）： 1955-1969. doi:10.1042/cs20170127 doi: 10.1042/cs20170127
28	LIS P， DYLĄG M， NIEDŹWIECKA K， et al. The HK2 Dependent "Warburg Effect" and Mitochondrial Oxidative Phosphorylation in Cancer： Targets for Effective Therapy with 3-Bromopyruvate ［J］. Molecules， 2016， 21（12）： 1730. doi:10.3390/molecules21121730 doi: 10.3390/molecules21121730
29	BELLOMO R， KELLUM J A， RONCO C. Acute kidney injury ［J］. Lancet， 2012， 380（9843）： 756-766. doi:10.1016/s0140-6736(11)61454-2 doi: 10.1016/s0140-6736(11)61454-2
30	ALI T， KHAN I， SIMPSON W， et al. Incidence and outcomes in acute kidney injury： a comprehensive population-based study ［J］. J Am Soc Nephrol， 2007， 18（4）： 1292-1298. doi:10.1681/asn.2006070756 doi: 10.1681/asn.2006070756
31	PAGLIARINI D J， CALVO S E， CHANG B， et al. A mitochondrial protein compendium elucidates complex I disease biology ［J］. Cell， 2008， 134（1）： 112-123. doi:10.1016/j.cell.2008.06.016 doi: 10.1016/j.cell.2008.06.016
32	O'CONNOR P M. Renal oxygen delivery： matching delivery to metabolic demand ［J］. Clin Exp Pharmacol Physiol， 2006， 33（10）： 961-967. doi:10.1111/j.1440-1681.2006.04475.x doi: 10.1111/j.1440-1681.2006.04475.x
33	SUN J， ZHANG J， TIAN J， et al. Mitochondria in Sepsis-Induced AKI ［J］. J Am Soc Nephrol， 2019， 30（7）： 1151-1161. doi:10.1681/asn.2018111126 doi: 10.1681/asn.2018111126
34	JIANG M， BAI M， LEI J， et al. Mitochondrial dysfunction and the AKI-to-CKD transition ［J］. Am J Physiol Renal Physiol， 2020， 319（6）： F1105-F1116. doi:10.1152/ajprenal.00285.2020 doi: 10.1152/ajprenal.00285.2020
35	RYOO S M， LEE J， LEE Y S， et al. Lactate Level Versus Lactate Clearance for Predicting Mortality in Patients With Septic Shock Defined by Sepsis-3 ［J］. Crit Care Med， 2018， 46（6）： e489-e495. doi:10.1097/ccm.0000000000003030 doi: 10.1097/ccm.0000000000003030
36	ZAGER R A， JOHNSON A C， BECKER K. Renal cortical pyruvate depletion during AKI ［J］. J Am Soc Nephrol， 2014， 25（5）： 998-1012. doi:10.1681/asn.2013070791 doi: 10.1681/asn.2013070791
37	ZAGER R A， JOHNSON A C， NAITO M， et al. Maleate nephrotoxicity： mechanisms of injury and correlates with ischemic/hypoxic tubular cell death ［J］. Am J Physiol Renal Physiol， 2008， 294（1）： F187-197. doi:10.1152/ajprenal.00434.2007 doi: 10.1152/ajprenal.00434.2007

基因名称	上游引物	下游引物
CCND1（Human）	GCTGCGAAGTGGAAACCATCG	CCTCCTTCTGCACACATTTGAA
CCND1（Mouse）	GCGTACCCTGACACCAATCTC	ACTTGAAGTAAGATACGGAGGGC
Kim-1（Human）	TGGCAGATTCTGTAGCTGGTT	AGAGAACATGAGCCTCTATTCCA
Kim-1（Mouse）	ACATATCGTGGAATCACAACGAC	ACAAGCAGAAGATGGGCATTG
β-Actin（Human）	CCTTCCTGGGCATGGAGTC	TGATCTTCATTGTGCTGGGTG
β-Actin（Mouse）	GCCAACCGTGAAAAGATGAC	CAGAGGCATACAGGGACAGC
HK2（Human）	GAGCCACCACTCACCCTACT	CCAGGCATTCGGCAATGTG
HK2（Mouse）	ATGATCGCCTGCTTATTCACG	CGCCTAGAAATCTCCAGAAGGG
PKM2（Human）	ATGTCGAAGCCCCATAGTGAA	TGGGTGGTGAATCAATGTCCA
PKM2（Mouse）	CGCCTGGACATTGACTCTG	GAAATTCAGCCGAGCCACATT
LDHA（Human）	ATGGCAACTCTAAAGGATCAGC	CCAACCCCAACAACTGTAATCT
LDHA（Mouse）	CAAAGACTACTGTGTAACTGCGA	TGGACTGTACTTGACAATGTTGG

[1]	Ting HUANG,Rongcheng XIE,Yuting WANG,Xiaoming LIN,Jiefei. MA. Values of renal resistance index combined with blood and urinary biomarkers in early prediction of contrast⁃induced acute kidney injury after interventional surgery [J]. The Journal of Practical Medicine, 2024, 40(7): 1011-1016.
[2]	Chengcai DAI,Zhenxing CHENG,Qianqian TU. The prognostic value of serum cystatin C combined with bedside renal ultrasound in patients with sepsis⁃induced acute kidney injury [J]. The Journal of Practical Medicine, 2024, 40(22): 3226-3231.
[3]	Kunyuan HUANG,Kehua JIANG,Qing WANG. Research progress of S100A9 in renal diseases [J]. The Journal of Practical Medicine, 2024, 40(22): 3251-3255.
[4]	Lili TANG,Xinyu WANG,Jie ZHANG,Yue ZHAO,Xiaoyue LI. Research progress on the relationship between m6A methylation modification and acute kidney injury [J]. The Journal of Practical Medicine, 2024, 40(2): 278-282.
[5]	Xing CAI,Xinglong MA,Changjian ZHOU,Peng XIE,Songxuan SHEN,Yanmei MIAO,Jiamei SONG,Leiyu. XIE. The research progress of macrophage glycolysis in sepsis [J]. The Journal of Practical Medicine, 2024, 40(19): 2783-2788.
[6]	Wei JIANG,Hui WANG,Zhongwei HUANG,Xinzhong. HUANG. The predictive value of soluble ST2 in sepsis⁃associated acute kidney injury [J]. The Journal of Practical Medicine, 2024, 40(16): 2291-2297.
[7]	Guomin ZHAO,Hui ZHANG,Pucong YE,Wei. CHEN. Effect of lactate dehydrogenase to albumin ratio on the short⁃term prognosis in patients with sepsis⁃associated acute kidney injury [J]. The Journal of Practical Medicine, 2024, 40(13): 1803-1807.
[8]	Yufeng JIN,Cunyi SHEN,Jingyao ZHANG,Yulong XUE,Dong. HE. Observation on the application effect of local citrate anticoagulation in CRRT tandem artificial liver treatment [J]. The Journal of Practical Medicine, 2024, 40(13): 1879-1884.
[9]	Wei WANG,Xinxin ZHANG,Guanghui WANG,Jie ZHANG,Anran CHEN,Jianguang. JIA. TMSB10 promotes gastric cancer proliferation and glycolysis based on activation of AMPK/mTOR signaling pathway [J]. The Journal of Practical Medicine, 2024, 40(11): 1519-1525.
[10]	Yinbi ZHENG,Yiming SHAO,Zhaoji LI,Shiting LI,Mingdi CHEN,Wenchi ZENG,Hongyu. DONG. Effect of dexmedetomidine on renal function in patients with septic⁃associated acute kidney injury： A cohort study [J]. The Journal of Practical Medicine, 2024, 40(10): 1423-1428.
[11]	LI Jing, LU Qinqin, CUI Yanfei.. Early diagnostic value of serum PGC⁃1α level for secondary acute kidney injury in patients with sepsis [J]. The Journal of Practical Medicine, 2023, 39(4): 471-475.
[12]	LI Xiaoling, ZHOU Wenjie, DENG Wei, MA Xigang.. Prognostic value of coagulation function index combined with serum cystatin C in patients with septic acute kidney injury [J]. The Journal of Practical Medicine, 2023, 39(1): 81-85.
[13]	WU Yanli, ZHOU Wenjie, LI Xiaoling, MA Xigang.. Correlation between serum NOD⁃like receptor protein 3，interleukin⁃18 and severity of septicacute kidneyinjury [J]. The Journal of Practical Medicine, 2022, 38(4): 484-489.
[14]	YANG Linlin, LIU Gang, YI Rui, WANG Juan, XIE Zhenhua, LIU Chengqiong, CHEN Jie. Research progress on risk prediction of acute renal injury [J]. The Journal of Practical Medicine, 2022, 38(18): 2367-2372.
[15]	DENG Linlin, ZHANG Xiao, GAO Yi, GONG Yuanqi, LAN Haibing.. Mechanism of involvement of miR⁃216a insepsis⁃inducedacute kidney injury by regulating NF⁃κB signaling pathway [J]. The Journal of Practical Medicine, 2022, 38(17): 2133-2137.

The mechanism of cyclin D1 ameliorates renal ischemia⁃reperfusion⁃induced acute kidney injury by promotingglycolysis

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 37

Related Articles 15

Recommended Articles

Metrics

Comments